Ets-1 jest krytycznym regulatorem zapalenia i przebudowy naczyń krwionośnych Ang II ad 9

Analizę ChIP przeprowadzono przy użyciu Chip Assay Kit (Upstate), zgodnie z instrukcjami producenta z niewielkimi modyfikacjami. Pokrótce, w sumie x 106 komórek usieciowano 1% formaldehydem przez 10 minut w temperaturze pokojowej, po czym przemyto dwukrotnie lodowato zimnym PBS zawierającym inhibitory proteazy (1 mM fluorek fenylometylosulfonylowy, (ig / ml pepstain A i 1. g / ml aprotyniny). Po zeskrobaniu komórek do stożkowej probówki i odwirowaniu przy 268 gw temperaturze 4 ° C przez 4 minuty, peletki komórek ponownie zawieszono w 200 ul buforu do lizy SDS i inkubowano na lodzie przez 10 minut. Lizaty sonikowano w celu ścinania DNA na długości między 500 a 750 bp (potwierdzone przez PCR) przy użyciu 550 Sonic Dismembrator (Fisher Scientific) zgodnie z instrukcjami producenta. W celu immunoprecypitacji lizaty inkubowano z poliklonalnym przeciwciałem Ets-1 (Santa Cruz Biotechnology Inc.) w 4 ° C przez noc. Po immunoprecypitacji perełki przemywano jednokrotnie buforem do płukania o niskim stężeniu soli immunologicznej, raz buforem do płukania kompleksu immunologicznego o wysokiej zawartości soli, raz buforem do płukania kompleksu immunologicznego LiCl i dwukrotnie buforem Tris-EDTA. Oddzieliliśmy kompleksy histon-DNA od przeciwciała, dodając 250 .l świeżego buforu elucyjnego (1% SDS, 0,1 M NaHCO3) i inkubując kulki w temperaturze pokojowej przez 15 minut z obrotem. Po odwirowaniu zebrano supernatant. Usieciowane kompleksy histon-DNA oddzielono przez dodanie 20 .l 5 M NaCl i ogrzewanie w 65 ° C przez 4 godziny. DNA odzyskano przy użyciu zestawu MinElute PCR Purification Kit (katalog 28004; QIAGEN). Startery odpowiadające 4 regionom w ludzkim promotorze MCP-1 pokazanym w Tabeli zastosowano do PCR. Tabela Sekwencja nukleonukleotydowa starterów stosowanych do immunoprecypitacji chromatyny Próby zmiany ruchomości żelu. W celu określenia interakcji DNA-białko, EMSA przeprowadzono w sposób opisany wcześniej szczegółowo (64). Sekwencje dla oligonukleotydów odpowiadających miejscu wiązania Ets-1 (3 w promotorze MCP-1 były: GTCATGCCACAGGATGTCTA (-2253MCP-1) i GTCATGCCACAGGCTGTCTA (mutant-2253MCP-1). Analiza statystyczna. Dane są przedstawione jako średnie. SEM. Statystyczne znaczenie różnic analizowano za pomocą ANOVA z kolejnym testem Dunnetta. Materiał uzupełniający Zobacz Dodatkowe dane Podziękowania Niniejsza praca została wsparta przez granty NIH HL-67219 (do P. Oettgen) i P01 HL76540-01 (do P. Oettgen). Przypisy Patrz odnośny komentarz od strony 2319. Zastosowano niestandardowe skróty: ChIP, immunoprecypitacja chromatyny; HASMC, ludzka aortalna SMC; KLF5, współczynnik transkrypcji palca cynkowego typu 5, podobny do Krueppela; MCP-1, białko chemotaktyczne monocytów A 1; PAI-1, inhibitor aktywatora plazminogenu a 1; RASMC, szczura aortalna SMC. Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów.
[więcej w: staw ramienno promieniowy, komornik sądowy beata rusin, mazak gostyń ]
[więcej w: duszacy kaszel, mazak gostyń, protruzja krążka ]